Search Skills

bio-single-cell-clustering

Reference examples tested with: ggplot2 3.5+, matplotlib 3.8+, scanpy 1.10+ Before using code patterns, verify installed versions match. If versions d...

by FreedomIntelligence

github 4 files

bio-single-cell-doublet-detection

Reference examples tested with: matplotlib 3.8+, numpy 1.26+, scanpy 1.10+ Before using code patterns, verify installed versions match. If versions di...

by FreedomIntelligence

github 4 files

bio-single-cell-metabolite-communication

Reference examples tested with: matplotlib 3.8+, scanpy 1.10+ Before using code patterns, verify installed versions match. If versions differ: Python:...

by FreedomIntelligence

github 3 files

bio-single-cell-scatac-analysis

Reference examples tested with: MACS2 2.2+, scanpy 1.10+ Before using code patterns, verify installed versions match. If versions differ: R: packageVe...

by FreedomIntelligence

github 4 files

bio-single-cell-trajectory-inference

Reference examples tested with: Cell Ranger 8.0+, scanpy 1.10+ Before using code patterns, verify installed versions match. If versions differ: Python...

by FreedomIntelligence

github 4 files

bio-small-rna-seq-mirdeep2-analysis

Collapsed reads (FASTA) mapper.pl ---------> Align to genome, create ARF file miRDeep2.pl -------> Predict novel miRNAs, quantify known quantifier.pl ...

by FreedomIntelligence

github 3 files

bio-small-rna-seq-smrna-preprocessing

Small RNA libraries have specific 3' adapters that must be removed: cutadapt \ -a TGGAATTCTCGGGTGCCAAGG \ -m 18 \ -M 30 \ --discard-untrimmed \ -o tri...

by FreedomIntelligence

github 3 files

bio-spatial-transcriptomics-spatial-data-io

Reference examples tested with: anndata 0.10+, numpy 1.26+, pandas 2.2+, scanpy 1.10+, spatialdata 0.1+, squidpy 1.3+ Before using code patterns, veri...

by FreedomIntelligence

github 3 files

bio-spatial-transcriptomics-spatial-multiomics

Reference examples tested with: Cellpose 3.0+, matplotlib 3.8+, numpy 1.26+, scanpy 1.10+, scipy 1.12+, spatialdata 0.1+, squidpy 1.3+ Before using co...

by FreedomIntelligence

github 4 files

bio-spatial-transcriptomics-spatial-neighbors

Reference examples tested with: matplotlib 3.8+, numpy 1.26+, scanpy 1.10+, scikit-learn 1.4+, scipy 1.12+, squidpy 1.3+ Before using code patterns, v...

by FreedomIntelligence

github 3 files

bio-spatial-transcriptomics-spatial-proteomics

Reference examples tested with: anndata 0.10+, scanpy 1.10+, squidpy 1.3+ Before using code patterns, verify installed versions match. If versions dif...

by FreedomIntelligence

github 3 files

bio-spatial-transcriptomics-spatial-visualization

Reference examples tested with: matplotlib 3.8+, numpy 1.26+, scanpy 1.10+, squidpy 1.3+ Before using code patterns, verify installed versions match. ...

by FreedomIntelligence

github 3 files